The recent determination of the three-dimensional structure of the trrj repressor of Escherichia coli (1) and the Isolation and characterization of many classes of trp_ repressor mutants
نویسنده
چکیده
Two small, multicopy, expression plasmids were constructed that permit convenient Insert ion of trpR. the structural gene for the t r £ repressor of Escherichja c o l l . with I t s natural rlbosome binding s i te or adjacent to the Mbosome bindTn? s i te for the t r £ leader peptide. In these plasmids trpR 1s positioned between the strong regulated ta£ promoter and the rpoC transcr ipt ion terminator. IPTG Induction of laclQ strains bearing these plasmids results 1n the production of 25-50% of the soluble cel l protein as t rp repressor. Mutant and wild type repressors overproduced 1n th is manner have been pur i f ied by simple procedures. INTRODUCTION The recent determination of the three-dimensional structure of the trrj repressor of Escherichia coli (1) and the Isolation and characterization of many classes of trp_ repressor mutants (2) have Increased the need for a general expression vector that may be used to produce large amounts of mutant and wild type repressors. High level expression of trpR from Its own expression signals 1s not feasible since the trpR promoter 1s relatively weak and translation Initiation at the trpR rlbosome binding site 1s Inefficient (3). In addition, overproduced active trrj. repressor can be toxic to growing cells, so regulated production seems essential (4). The trj> repressor expression vector previously employed, pRLK18, contained tandem trp_ promoter-operators rather than the trp« promoter (5). Expression directed by this vector was Induced somewhat by addition of the tryptophan analog 1ndole-3-acryl1c add to growing cultures (5). Using this plasmid and optimal growth and expression conditions, cell extracts were obtained that contained 2 to 5% of their protein as trrj repressor (5). To Improve the yield of wild type and mutant t r£ repressors, we have developed expression plasmids that Incorporate the following general features: (a) high plasmid copy number, (b) the strong, regulated tac promoter directing transcription (6,7), (c) appropriate cloning sites allowing Insertion of a 430 bp fragment that TOE i © IRL Press Limited, Oxford, England. Nucleic Acids Research contains the trp_ repressor coding reg ion, (d) the strong rpoC t r a n s c r i p t i o n terminat ion region (8) immediately fo l low ing the c lon ing s i t e s , and (e) sequences tha t permit the replacement of the trpR ribosome binding s i t e region by synthet ic DNA conta in ing the ribosome binding s i t e f o r the trp_ leader pept ide. Using these plasmids 1n appropriate l a d 0 , s t ra ins and delayed IPTG Induc t ion , c e l l s can produce 25-50% of t h e i r soluble p ro te in as mutant or w i ld type repressor. Uninduced cu l tures contain about 0.5% repressor. The high repressor content of crude ext rac ts permits rapid p u r i f i c a t i o n by simple procedures: a heat s tep , ammonium su l fa te f r a c t i o n a l on, and a s ing le chromatographic run on a phosphocellulose column. Mutant repressor peaks are read i l y I d e n t i f i a b l e 1n the phosphocellulose column e lua te . The development of these plasmids should f a c i l i t a t e studies w i th w i l d type and mutant t r p repressors. MATERIALS AND METHODS Strains Three trpR l a c l i s t ra ins were constructed and tested f o r basal level contro l of the t a£ promoter/operator of pJPRl and pJPR2. S t ra in JM101 SRT4 1s a trpR de r i va t i ve of the JM101 F' laclQ s t r a i n of Messing (9) I n to which the serBt rpR-thr segment of the E_̂ c o l i chromosome was Introduced by cotransduction w i th an adjacent TnlO. St ra in CY15070, a de r i va t i ve of E. c o l l W3110, 1s tnaA2 trpR2 l a c j j l ( l a c i q was Introduced by cotransduct ion wi th TnlO from s t r a i n DS1210 ( 6 ) ) . S t ra in CY15071 1s a de r i va t i ve of CY15O70 1n which the trpR t h r region has been de le ted . The three l a c l ^ s t ra ins mentioned behaved s i m i l a r l y 1n expression s tud ies . Construct ion of the trpR inse r t of pJPR2 A 403 bp BamHI fragment was constructed tha t contained the E_j_ c o l i trpR coding region fused t o a synthet ic trj> leader ribosome binding s i t e . This fragment was Inser ted i n t o an expression vector designated ptacterm (Figure I and Results) t o construct the trpR expression plasmid pJPR2 (Figure 2 ) . To construct the 403 bp BamHI fragment two overlapping o l igonuc leo t ides , the 22-mer 5'GKCAnGTTATTCTCTAATTG3'and the 23-mer 5 'GATCCAATTAGAGAATAACAATG3', were designed so tha t when annealed they would form a synthet ic t r p leader ribosome binding s i t e fragment w i th BamHI and Sau?6I ends. These ol igonuc leot ides were k ind ly provided by Karl Pope and Gerard Zurawski of the DNAX Research I n s t i t u t e . Annealing of the o l igonuc leot ides was performed at 85°C in 20 pi of bu f fe r contain ing 25 Mm Tr i s -HCl , pH 7 .5 , 10 mM MgCl2 and 5 ug o f each o l i gonuc leo t i de . The mixture was s lowly cooled t o room temperature
منابع مشابه
Study of Organic Solvent Tolerance and Increased Antibiotic Resistance Properties in E. coli gyrA Mutants
Ciprofloxacin is one of the most widely used antibiotics for the treatment of several infections caused by Gram-negative bacteria, like E. coli. Changes in gyrA, encoding GyrA subunit of DNA gyrase, cause the resistance to ciprofloxacin. Some ciprofloxacin resistant gyrA mutants acquired constitutive expression of marRAB operon due to the gaining mutations in marR, a repressor of this operon...
متن کاملStudy of Organic Solvent Tolerance and Increased Antibiotic Resistance Properties in E. coli gyrA Mutants
Ciprofloxacin is one of the most widely used antibiotics for the treatment of several infections caused by Gram-negative bacteria, like E. coli. Changes in gyrA, encoding GyrA subunit of DNA gyrase, cause the resistance to ciprofloxacin. Some ciprofloxacin resistant gyrA mutants acquired constitutive expression of marRAB operon due to the gaining mutations in marR, a repressor of this operon...
متن کاملStudy of Mutations in the DNA gyrase gyrA Gene of Escherichia coli
Quinolones are a large and widely consumed class of synthetic drugs. Expanded-spectrum quinolones, like ciprofloxacin are highly effective against Gram-negative bacteria, especially Escherichia coli. In E. coli the major target for quinolones is DNA gyrase. This enzyme is composed of two subunits, GyrA and GyrB encoding by gyrA and gyrB, respectively. Mutations in either of these genes cause qu...
متن کاملStudy of Mutations in the DNA gyrase gyrA Gene of Escherichia coli
Quinolones are a large and widely consumed class of synthetic drugs. Expanded-spectrum quinolones, like ciprofloxacin are highly effective against Gram-negative bacteria, especially Escherichia coli. In E. coli the major target for quinolones is DNA gyrase. This enzyme is composed of two subunits, GyrA and GyrB encoding by gyrA and gyrB, respectively. Mutations in either of these genes cause qu...
متن کاملConstruction of New Genetic Tools as Alternatives for Protein Overexpression in Escherichia coli and Pseudomonas aeruginosa
Background: Pseudomonas protein expression in E. coli is known to be a setback due to signifi cant genetic variation and absence of several genetic elements in E. coli for regulation and activation of Pseudomonas proteins. Modifi cations in promoter/repressor system and shuttle plasmid maintenance have made the expression of stable and active Pseudomonas protein possible in bot...
متن کامل